View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_high_35 (Length: 233)
Name: NF19590_high_35
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 71 - 148
Target Start/End: Complemental strand, 26895566 - 26895489
Alignment:
| Q |
71 |
catcaaaatcatggattgcaactaacattttattttttccatttgtaatgacagtgacccctataggtattcatatct |
148 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26895566 |
catcaaaatcatggactgcaactaacatcttattttttccatttgtaatgacagtgacccctataggtattcatatct |
26895489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 26895619 - 26895586
Alignment:
| Q |
18 |
agtcatgactgctaccaacaacttaacgttttat |
51 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
26895619 |
agtcatgactgccaccaacaacttaacgttttat |
26895586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University