View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_low_19 (Length: 314)
Name: NF19590_low_19
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 299
Target Start/End: Original strand, 10296127 - 10296410
Alignment:
| Q |
18 |
aatagtttggatggcatcaaacttggtaataaaaatgaaacgtggcagttctgagtggtttgtgcaactatatggaatggaattccacttgctatctgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10296127 |
aatagtttggatggcatcaaacttggtaataaaaatgaaacgtggcagttctgagtggtttgtgcaactatatggaatggaattccacttgctatctgtc |
10296226 |
T |
|
| Q |
118 |
cttatcttgatcactacttcttagcatcttcaggaaatactgtaagttggataaaccttgtatgtttacctcttcgcataagaaaactacatttggttac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10296227 |
cttatcttgatcactacttcttagcatcttcaggaaatactgtaagttggataaaccttgtatgtttacctcttcgcataagaaaactacatttggttac |
10296326 |
T |
|
| Q |
218 |
tgttttctcatttaattattttctggttattcagttctatgtctgtgctttaga--atgacactactttgattgggagagttaa |
299 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10296327 |
tgttttctcatttaattattttcttgttattcagttctatgtctgtgctttagaatatgacactactttgattgggagagttaa |
10296410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 15 - 146
Target Start/End: Complemental strand, 43795723 - 43795595
Alignment:
| Q |
15 |
gataatagtttggatggcatcaaacttggtaataaaaatgaaacgtggcagttctgagtggtttgtgcaactatatggaatggaattccacttgctatct |
114 |
Q |
| |
|
|||||||| || |||||||||||||||| || ||||||||| ||||||||| || ||| || |||||||| |||| | |||||| || || |||| |
|
|
| T |
43795723 |
gataatagctttgatggcatcaaacttg---atgaaaatgaaatttggcagttccgattggcttctgcaactacatggcagggaattgtacaagcgatct |
43795627 |
T |
|
| Q |
115 |
gtccttatcttgatcactacttcttagcatct |
146 |
Q |
| |
|
||||||||||||||| ||| || || |||||| |
|
|
| T |
43795626 |
gtccttatcttgatcgctattttttggcatct |
43795595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University