View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_low_21 (Length: 304)
Name: NF19590_low_21
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_low_21 |
 |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 7 - 283
Target Start/End: Complemental strand, 30235 - 29959
Alignment:
| Q |
7 |
tcgaagaatatgacggaagcttttttgcaaaagtatttgaacatatcttcgccgagttcgttgaggatttcagcgttggatggatcttcatcgttgaggt |
106 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30235 |
tcgaagaacatgacggaagctcttttgcaaaagtatttgaacatatcttcgccgagttcgttgaggatttcagcgttggatggatcttcatcgttgaggt |
30136 |
T |
 |
| Q |
107 |
cgatgtccatttcagtgtagatgttagcgtctttgcttgaacctatgtgatcctccattagtacggagatggaaaattagggtttatggagaaaggattt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30135 |
cgatgtccatttcagtgtagatgttagcgtctttgcttgaacctatgtgatcctccattagtaaggagatggaaaattagggtttatggagaaaggattt |
30036 |
T |
 |
| Q |
207 |
tggtacaatttacaccattagtgtactgtggagtgtgactctgagtttttgcggaaatgtgtagtgggcaaaagcaa |
283 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30035 |
tggtacaatttacaccattagtgtaatgtggagtgtgactctgagtttttgcggaaatgtttagtgggcaaaagcaa |
29959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 6 - 217
Target Start/End: Original strand, 48883452 - 48883671
Alignment:
| Q |
6 |
gtcgaagaatatgacggaagcttttttgcaaaagtatttgaacatatcttcgccgagttcgttgaggatttcagcgttggatggatcttcatcgttg--- |
102 |
Q |
| |
|
||||||||| || ||||||||||| |||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||| |||||||||||| | |
|
|
| T |
48883452 |
gtcgaagaacataacggaagctttcttgcaaaagtatttgaccatatcgtcgccgagttcgttgaggatttcggcgttggattgatcttcatcgtcgtca |
48883551 |
T |
 |
| Q |
103 |
aggtcgatgtccatttcagtgta------gatgttagcgtctttgcttgaacctatgtgatcctccat--tagtacggagatggaaaattagggtttatg |
194 |
Q |
| |
|
||||| ||||||||||| ||||| | ||||||| |||||||||||||||||||| ||||| | || || ||| |||||||||||||||| |
|
|
| T |
48883552 |
aggtcaatgtccatttctgtgtagttggtgttgttagcatctttgcttgaacctatgtg---ttccattgtggttgagaaatgaaaaattagggtttatg |
48883648 |
T |
 |
| Q |
195 |
gagaaaggattttggtacaattt |
217 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
48883649 |
gagaaagggttttggtacaattt |
48883671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 21 - 89
Target Start/End: Original strand, 53014730 - 53014798
Alignment:
| Q |
21 |
ggaagcttttttgcaaaagtatttgaacatatcttcgccgagttcgttgaggatttcagcgttggatgg |
89 |
Q |
| |
|
||||||||||||||| || ||||||| ||| ||||| || |||||||||||||||||||| || ||||| |
|
|
| T |
53014730 |
ggaagcttttttgcagaaatatttgaccatgtcttcacctagttcgttgaggatttcagcatttgatgg |
53014798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University