View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_low_22 (Length: 299)
Name: NF19590_low_22
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 16961131 - 16960853
Alignment:
| Q |
1 |
agtttcacttgtgcttagaaacaatagctttaggcttggtataccttctaatataagttctttatatcaacttcagaaattggacctttctttgaatggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16961131 |
agtttcacttgtgcttagaaacaatagctttaggcttggtataccttctaatataagttctttatatcaacttcagaaattggacctttctttgaatggt |
16961032 |
T |
|
| Q |
101 |
tttgtaggaccgtttccaccgtctttattgtcactcccttcgatcaattaccttgatgtttcttcaaataagttcactggtatgcttttcaagaattttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16961031 |
tttgtaggaccgtttccaccgtctttattgtcactcccttcgatcaattaccttgatgtttcttcaaataagttcactggtatgcttttcaagaattttt |
16960932 |
T |
|
| Q |
201 |
catgcaatgaggatcttcactttgtgaatttatcttcaaatcttttgaaaggtgaactacctagttgtttgagaccaaa |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16960931 |
catgcaatgaggatcttcactttgtgaatttatcttcaaatcttttgaaaggtgaactacctagttgtttgagaccaaa |
16960853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University