View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_low_26 (Length: 258)
Name: NF19590_low_26
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 126 - 191
Target Start/End: Original strand, 34280973 - 34281038
Alignment:
| Q |
126 |
atttgatgaatgttaaatgatcgttagtggggattaattaggattatatagatgcattgcgtaatt |
191 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34280973 |
atttgatgaatattaaatgatcgttagtggggattaattaggattatatagatgcattgcgtaatt |
34281038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 50
Target Start/End: Original strand, 34280935 - 34280968
Alignment:
| Q |
17 |
ttattttgaggtttagggtgtcacaaactcgtta |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34280935 |
ttattttgaggtttagggtgtcacaaactcgtta |
34280968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University