View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_low_28 (Length: 250)
Name: NF19590_low_28
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 16910250 - 16910016
Alignment:
| Q |
19 |
ttcttgatgacaagtttttgcctagaattggtgactttgggctagcaagattttttccagaagaccaagcttatcttagcacacagtttgcaggaacatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910250 |
ttcttgatgacaagtttttgcctagaattggtgactttgggctagcaagattttttccagaagaccaagcttatcttagcacacagtttgcaggaacatt |
16910151 |
T |
|
| Q |
119 |
gtatgtcttctattgaaacaaattttacatttt-----------------tatggacaaaacattactttaattttctatatctatctatattgccttaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
16910150 |
gtatgtcttctattgaaacaaattttacatttttattaaaaaatgcatactatcgacaaaacattactttaattttctatatctatccatgttgccttaa |
16910051 |
T |
|
| Q |
202 |
ttcaatgcgtttatggtgttcgtcacataaaagtg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910050 |
ttcaatgcgtttatggtgttcgtcacataaaagtg |
16910016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 121
Target Start/End: Original strand, 52601230 - 52601332
Alignment:
| Q |
19 |
ttcttgatgacaagtttttgcctagaattggtgactttgggctagcaagattttttccagaagaccaagcttatcttagcacacagtttgcaggaacatt |
118 |
Q |
| |
|
||||||| || |||||| ||| || ||||| || ||||| ||||| || || || || |||||||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
52601230 |
ttcttgacgaaaagtttcagccgaggattggagattttggactagctaggttcttccctgaagaccaagcttaccttagcactcagtttgccggaacatt |
52601329 |
T |
|
| Q |
119 |
gta |
121 |
Q |
| |
|
||| |
|
|
| T |
52601330 |
gta |
52601332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University