View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_low_33 (Length: 237)
Name: NF19590_low_33
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 102 - 221
Target Start/End: Complemental strand, 34848886 - 34848767
Alignment:
| Q |
102 |
caaactcaacatattgaagcagacatatctttagaagatgcacatagcttagaaaatggttctgtagaaatgtgatttagaaaatgtactaatatatgac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
34848886 |
caaactcaacatattgaagcagacatatctttagaagatgcacatagcttagaaaatggttttgtagaaatgtgctttagaaaatgtactaatatatggc |
34848787 |
T |
 |
| Q |
202 |
tttaattgtggttagttaag |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34848786 |
tttaattgtggttagttaag |
34848767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 34849023 - 34848919
Alignment:
| Q |
1 |
atctcaaaacctaaaacgctaacttagattactcgacccttgggtcaactttgggataaaaaaggagggaagcaatggattcttccaaagcagaaatttc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34849023 |
atctcaaaacctagaacgctaacttagattactcgacccttggg-----------ataaaaaaggagggaaacaatggattcttccaaagcagaaatttc |
34848935 |
T |
 |
| Q |
101 |
acaaactcaacatatt |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34848934 |
acaaactcaacatatt |
34848919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University