View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19590_low_36 (Length: 233)

Name: NF19590_low_36
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19590_low_36
NF19590_low_36
[»] chr3 (2 HSPs)
chr3 (71-148)||(26895489-26895566)
chr3 (18-51)||(26895586-26895619)


Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 71 - 148
Target Start/End: Complemental strand, 26895566 - 26895489
Alignment:
71 catcaaaatcatggattgcaactaacattttattttttccatttgtaatgacagtgacccctataggtattcatatct 148  Q
    ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
26895566 catcaaaatcatggactgcaactaacatcttattttttccatttgtaatgacagtgacccctataggtattcatatct 26895489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 26895619 - 26895586
Alignment:
18 agtcatgactgctaccaacaacttaacgttttat 51  Q
    |||||||||||| |||||||||||||||||||||    
26895619 agtcatgactgccaccaacaacttaacgttttat 26895586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University