View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_low_39 (Length: 215)
Name: NF19590_low_39
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 8261621 - 8261830
Alignment:
| Q |
1 |
cttatcaaaaaagtgatgaacctttaaaaagaatcaaactaaacataaagattgatttgtcttttcactttaatcaagtccctacctcccaaaattgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8261621 |
cttatcaaaaaagtgatgaacctttaaaaagaatcaaactaaacataaagattgatttgtcttttcactttaatcaagtccctacctcccaaaattgaaa |
8261720 |
T |
 |
| Q |
101 |
agaaaaaagttatacaaatttcatacctaccttaccaaattcatatttcatattccactcccaagaaattgatcataa-------gtcacataaaacata |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
8261721 |
agaaaaaagttatacaaatttcatacctaccttaccaaattcatatttcatattccactcccaagaaattgattataactccaacttcacataaaacata |
8261820 |
T |
 |
| Q |
194 |
tgcctatgct |
203 |
Q |
| |
|
|||||||||| |
|
|
| T |
8261821 |
tgcctatgct |
8261830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University