View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_low_8 (Length: 434)
Name: NF19590_low_8
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 12 - 284
Target Start/End: Original strand, 1792052 - 1792324
Alignment:
| Q |
12 |
aattctctagggaaaaggcattaatgggcctattaaaaccctgctcaacataattctaaaattatgaaaatataatttctcaattcaccctcttatatgc |
111 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
1792052 |
aattctctaaggaaaaggcatcaatgggcctattaaaaccctgctcaacataattctaaaattataaaaatataatttctcaattcacccccttatatgc |
1792151 |
T |
 |
| Q |
112 |
tcataggccctcaaaatacactatcgaatggatcctttcgatattatttcggctaaaatatattattgaaaggacctttcgatagctaatggggtcgcac |
211 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1792152 |
tcataggcccccaaaatacactatcggaaggatcctttcgatattatttcggataaaatacattattgaaaggacctttcgatagctaatggggtcatac |
1792251 |
T |
 |
| Q |
212 |
aggcagattgagaaattatcacaaaagaactatatgattagttttttgtattagcaaattttctagggacaaa |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792252 |
aggcagattgagaaattatcacaaaagaactatatgattagttttttgtattagcaaattttctagggacaaa |
1792324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University