View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19591_low_1 (Length: 253)
Name: NF19591_low_1
Description: NF19591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19591_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 2 - 239
Target Start/End: Original strand, 9902123 - 9902349
Alignment:
| Q |
2 |
gagaagaagaaaggagcagaagaagagaaaccctacgtgcgacaaggtcaaacgaatcgaggtggaagaggannnnnnnnnnnnnnnntgattattttac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
9902123 |
gagaagaagaaaggagcagaagaagagaaacccta-gtacgacaagttcaaacgaatcgaggtggaggaggagagggatggga------gattattttac |
9902215 |
T |
|
| Q |
102 |
tcatgggtattttagcgatcttggatagaggggtttgcgcttgaccccgaccgactttggcctagtttgtgtgtgtttgatgttttaataaatcatttat |
201 |
Q |
| |
|
||||| ||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9902216 |
tcatgtgtattttagcggtcttggatagaagggtttgcgcttgaccccga----ctttggcctagtttgtgtgtgtttgatgttttaataaatcatttat |
9902311 |
T |
|
| Q |
202 |
tgtctatgtgattgttattcattgtgaatattttgagt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9902312 |
tgtctatgtgattgttattcattgtgaatattttgagt |
9902349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University