View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19592_high_13 (Length: 236)
Name: NF19592_high_13
Description: NF19592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19592_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 21854970 - 21854751
Alignment:
| Q |
1 |
tttcaccctctacctcaagtagcctcaactcccaattnnnnnnn-tcaagtaaccaatgataaacaacatctcaacattgaattacaaaaaggcnnnnnn |
99 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21854970 |
tttcaccctctgcctcaagtagcctcaattcccaatttaaaaaaatcaagtaaccaatgataaacaacatctcaacattgaattacaaaaaggcaaaaaa |
21854871 |
T |
|
| Q |
100 |
nnnnttaaaaccaattaaagccaaaatcgaattgaagttaacacttaggaagatcagctggaggtggaagcaccttctgatttgggagctttccatccaa |
199 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21854870 |
aaagttaaaacaaattaaagccaaaatcaaattgaagttaacacttgggaagatcaactggaggtggaagcaccttctgatttgggagctttccatccaa |
21854771 |
T |
|
| Q |
200 |
aacaatccatgccatcttaa |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
21854770 |
aacaatccatgccatcttaa |
21854751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 131 - 214
Target Start/End: Complemental strand, 21206337 - 21206254
Alignment:
| Q |
131 |
ttgaagttaacacttaggaagatcagctggaggtggaagcaccttctgatttgggagctttccatccaaaacaatccatgccat |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
21206337 |
ttgaagttaacacttgggaagatcagctggtggtggaagcagcttctgatttgggagttttccatccaagacaatccatgccat |
21206254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 130 - 219
Target Start/End: Complemental strand, 21183835 - 21183746
Alignment:
| Q |
130 |
attgaagttaacacttaggaagatcagctggaggtggaagcaccttctgatttgggagctttccatccaaaacaatccatgccatcttaa |
219 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| | ||| |||||||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
21183835 |
attgaagttaacacttgggaagatcagctggtggtggaagtaacttttgatttggaagttttccatccaacacaatccatgccatcttaa |
21183746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University