View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19592_low_10 (Length: 240)
Name: NF19592_low_10
Description: NF19592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19592_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 32622350 - 32622143
Alignment:
| Q |
15 |
agcagagaaacgggaggcgtggaagaagaaaggtcatggtgaatttagggaggtaactgaaggggatttcttgggtgaagtcactggaagtgaaaaagtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32622350 |
agcagagaaacgggaggcgtggaagaagaaaggtcatggtgaatttagggaggtaactgaaggggatttcttgggtgaagtcactggaagtgaaaaagtg |
32622251 |
T |
 |
| Q |
115 |
atctgccatttctatcataaggaattctaccgatgcaagtatgcctttttactattgttcattgaatctaacatctgactccatctcttgatatctgagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32622250 |
atctgccatttctatcataaggaattctaccgatgcaagtatgcctttttactattgttcattgaatctaacatctgactccatctcttgatatctgagg |
32622151 |
T |
 |
| Q |
215 |
taacaatt |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
32622150 |
taacaatt |
32622143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University