View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19592_low_17 (Length: 201)

Name: NF19592_low_17
Description: NF19592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19592_low_17
NF19592_low_17
[»] chr5 (1 HSPs)
chr5 (105-183)||(34020671-34020749)


Alignment Details
Target: chr5 (Bit Score: 75; Significance: 9e-35; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 105 - 183
Target Start/End: Complemental strand, 34020749 - 34020671
Alignment:
105 gaggttcatatatgtatcgggtgagcctacggatgtatactattattactctgctgctcaaaatagagctgtagggttt 183  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34020749 gaggttcatatatgtgtcgggtgagcctacggatgtatactattattactctgctgctcaaaatagagctgtagggttt 34020671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University