View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19592_low_17 (Length: 201)
Name: NF19592_low_17
Description: NF19592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19592_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 9e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 105 - 183
Target Start/End: Complemental strand, 34020749 - 34020671
Alignment:
| Q |
105 |
gaggttcatatatgtatcgggtgagcctacggatgtatactattattactctgctgctcaaaatagagctgtagggttt |
183 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34020749 |
gaggttcatatatgtgtcgggtgagcctacggatgtatactattattactctgctgctcaaaatagagctgtagggttt |
34020671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University