View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19593_high_12 (Length: 287)
Name: NF19593_high_12
Description: NF19593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19593_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 269
Target Start/End: Complemental strand, 35415846 - 35415598
Alignment:
| Q |
11 |
cagagaccacaatgaagcttgatctgggttttgtggtggtcgtctgggtcgttcatcaccagcaacaccgccttggtattgttcccgtgtttgtggtttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35415846 |
cagagaccacaatgaagcttgatctgggttttgtggtggtcttctggatcgttcatcaccagcaacacctccttggtattgttcccgtgtttgtggtttt |
35415747 |
T |
|
| Q |
111 |
ctctaaaacccatgagagtatgtctgttttcttaaacagactcactgatttgtaggtgggttcgttgggtattgtttgttctatggttctgcagcaaaac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
35415746 |
ctctaaaacccatgagagtatgtctgttttcttaaacagactcactgatttgtaggtgggtcc----------gtttgttctatggttctgcagcaaaac |
35415657 |
T |
|
| Q |
211 |
cttgttgccgtcgtgttggttttgttttctcatacctggtttgcttcgcgcgtggttcg |
269 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35415656 |
cttgttgccgtcgtgttggttttcttttctcatacctggtttgcttcgcgcgtggttcg |
35415598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 269
Target Start/End: Complemental strand, 20114870 - 20114834
Alignment:
| Q |
233 |
tgttttctcatacctggtttgcttcgcgcgtggttcg |
269 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
20114870 |
tgttttctcagacctggtttgcttcgcgtgtggttcg |
20114834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University