View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19595_low_10 (Length: 237)
Name: NF19595_low_10
Description: NF19595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19595_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 122 - 219
Target Start/End: Complemental strand, 51426206 - 51426109
Alignment:
| Q |
122 |
caaattggagaatagaggtgtataaaatgatgattagaggtggtccatagtggtgattgaattggtgattcgaaatgttgattgaccggtggtggtca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51426206 |
caaattggagaatagaggtgtataaaatgatgattagaggtggtccatagtggttattgaattggtgattcgaaatgttgattgaccggtggtggtca |
51426109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 51426316 - 51426275
Alignment:
| Q |
12 |
caaaggtggatgaagtggtgatcaaggatggttagatcgtta |
53 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
51426316 |
caaaggttgatgaagtggtgatcaagaatggttagatcgtta |
51426275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University