View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19598_high_40 (Length: 272)
Name: NF19598_high_40
Description: NF19598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19598_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 83 - 266
Target Start/End: Complemental strand, 20637573 - 20637389
Alignment:
| Q |
83 |
tgcatgagcaccacttgatctggtacctctagtgcggttctggcctcttcctcaccctactgccttgtcatcatttctaggacgttcaccccaccaatct |
182 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
20637573 |
tgcacgagcaccacttgatccggtacctccagtgcggttttggcctcttcctcaccctactgccttgtcatcatttctgggacgttcaccccaccattct |
20637474 |
T |
 |
| Q |
183 |
gggtatccaattagcaag-aacaacccgcttcatcatgaccagctctgttgcaatgtgcacagacagatttgtttttcatctcac |
266 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
20637473 |
gggtatccaatcagcaagaaacaacccgcttcgtcatgaccaactctgttgcagtgtgcacagacagatttgtttttgatctcac |
20637389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 91
Target Start/End: Complemental strand, 20637663 - 20637592
Alignment:
| Q |
20 |
gcttaatcctgtcatgttggagttttttgaatctccaccaacattggatcccaaattctgatttgcatgagc |
91 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
20637663 |
gcttaattctgtcatgttggagttttctgaatctccaccaacattggatcccaagttctgaactgcatgagc |
20637592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University