View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19598_high_51 (Length: 242)
Name: NF19598_high_51
Description: NF19598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19598_high_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 21441918 - 21441716
Alignment:
| Q |
16 |
atcacttctcagttcaaaaattatgattagacgagtttgattatgttatagtaacgtgtattaagatgaaactgcgttatatattgaaccgttgagtaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21441918 |
atcacttctcagttcaaaaattatgattagacgagtttgattatgttatagtaacgtgtattaagatgaaactgcgttatatattgaaccgttgagtaat |
21441819 |
T |
 |
| Q |
116 |
gtgaaagggaatattcatgtatatgctcaggaacaccgacacgtttgatcaaaggcgtgttaatgtctaacaatgacatatgtgattatattcaattacg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21441818 |
gtgaaagggaatattcatgtatatgctcaggaacaccgacacgtttgattaaagacgagttaatgtctaacaatgacatatgtgattatattcaattacg |
21441719 |
T |
 |
| Q |
216 |
tca |
218 |
Q |
| |
|
||| |
|
|
| T |
21441718 |
tca |
21441716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 21440557 - 21440502
Alignment:
| Q |
121 |
agggaatattcatgtatatgctcaggaacaccgacacgtttgatcaaaggcgtgtt |
176 |
Q |
| |
|
||||||||||||||||||||||| | | ||||||||||| ||||||||| |||||| |
|
|
| T |
21440557 |
agggaatattcatgtatatgctctgtagcaccgacacgtatgatcaaagacgtgtt |
21440502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University