View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19598_high_52 (Length: 241)
Name: NF19598_high_52
Description: NF19598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19598_high_52 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 22 - 241
Target Start/End: Original strand, 8883724 - 8883943
Alignment:
| Q |
22 |
aaataccaaaatcatataactttgtaagaatattttgctgttgtctcagaattgttgcatcatttactaactcattattttaattgcatcatacaatcag |
121 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8883724 |
aaataccaaaatcatataaatttgtaagaatattttgctgttgtctcagaattgttgcatcatttactaactcattattttaattgcatcatacaatcag |
8883823 |
T |
 |
| Q |
122 |
aagcatgttcttctaacactataaccgtgcaaaacattggacactgattccctgcattgaaaaaagaacgaggttacacgcagatttccatctcgatggt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
8883824 |
aagcatgttcttctaacactataaccgtgcaaaacattggacactgattccctgcattgaaaaaagaacgcggttacacgcagatttccatcacgatggt |
8883923 |
T |
 |
| Q |
222 |
aaatacaagatcaaatggtt |
241 |
Q |
| |
|
||||| |||||| |||||| |
|
|
| T |
8883924 |
aaatatgagatcagatggtt |
8883943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University