View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19598_low_23 (Length: 386)
Name: NF19598_low_23
Description: NF19598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19598_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 12 - 371
Target Start/End: Complemental strand, 45974870 - 45974511
Alignment:
| Q |
12 |
gaaaatagtcgtgatcgtcatcggaggttgacaagcggcggtggaagtggtgagtatgatgaccggagtgtcgttttttgtcgataaaccagtcgcagaa |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974870 |
gaaaaaagtcgtgatcgtcatcggaggttgacaagcggcggtggaagtggtgagtaagatgaccggagtgtcgttttttgtcgataaaccagtcgcagaa |
45974771 |
T |
|
| Q |
112 |
agcagatatttgcttttgtctgaatcggagtttatcaccggcgacgaaatgtttgccggaggagaaaacggcgtcgttttttggtgttggaggagtagac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45974770 |
agcagatatttgcttttgtctgaatcggagtttatcaccggcgacggaatgtttgccggaggagaaaacggcatcgttttttggtgttggaggagtagac |
45974671 |
T |
|
| Q |
212 |
gaggaaagtgactttgtggttggagtgtcgttttcgattggagatttgatggagttgacgattttgtccttatcttgatctaatagctttttggatgatt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974670 |
gaggaaagtgactttgtggttggagtgtcgttttcgattggagatttgatggagttgacgattttgtccttatcttgatctaatagctttttggatgatt |
45974571 |
T |
|
| Q |
312 |
catccaatcctcgctccggaaattgacgcgggaaaaagtaagttgctctatgtggcattt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974570 |
catccaatcctcgctccggaaattgacgcgggaaaaagtaagttgctctatgtggcattt |
45974511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University