View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19598_low_34 (Length: 295)
Name: NF19598_low_34
Description: NF19598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19598_low_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 118 - 295
Target Start/End: Complemental strand, 35451350 - 35451174
Alignment:
| Q |
118 |
tgttaggcttaagtttgttggggctttcttatacactgtactatatacaacgaccacaacaaaacggtatcagccgtagtgccgttaccattttaaagga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35451350 |
tgttaggcttaagtttgttggggctttcttatacactgtactatatacaacgaccacaacaaaacggtatcagccgtagtgccgttaccgttttaaagga |
35451251 |
T |
 |
| Q |
218 |
attaatgnnnnnnnntaatcacaaactcaattgagctatgggttaaaagagttggaggttttgagttcaaactcaaac |
295 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35451250 |
attaatgaaaaaaaa-aatcacaaactcaattgatttatgggttaaaagagttggaggttttgggttcaaactcaaac |
35451174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 248 - 292
Target Start/End: Complemental strand, 9860817 - 9860773
Alignment:
| Q |
248 |
ttgagctatgggttaaaagagttggaggttttgagttcaaactca |
292 |
Q |
| |
|
|||||||| |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
9860817 |
ttgagctaagggttaaaggagttggaggtcctgagttcaaactca |
9860773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University