View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19598_low_36 (Length: 294)
Name: NF19598_low_36
Description: NF19598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19598_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 141 - 276
Target Start/End: Original strand, 15639631 - 15639766
Alignment:
| Q |
141 |
gagactaaccagaagaagaattccagggatggcatcaacattgccaggaaaaaaccctgcagccctaagaagaaggtgtacaaccattgacccaaccaca |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15639631 |
gagactaaccagaagaagaattccagggatggcatcaacattgccaggaaaaaaccctgcagccctaagaagaaggtgtacaaccattgacccaaccaca |
15639730 |
T |
 |
| Q |
241 |
gcagtcatgaatacagtgcacataagaaatgcatct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
15639731 |
gcagtcatgaatacagtgcacataagaaatgcatct |
15639766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 15639480 - 15639595
Alignment:
| Q |
1 |
cagaatagtccatgaagtgtcggtccagtgataaaagtttgacgttaaaatcacaaagaagttcgaaattcttgtataaggactagtagcgttcgtctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15639480 |
cagaatagtccatgaagtgtcggtccagagataaaagtttgacgttataatcacaaagaagttcgaaattcttgtataaggactagtagcgtccgtctct |
15639579 |
T |
 |
| Q |
101 |
ttattaaataataata |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
15639580 |
ttattaaataataata |
15639595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University