View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19598_low_58 (Length: 221)
Name: NF19598_low_58
Description: NF19598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19598_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 96 - 203
Target Start/End: Original strand, 42285128 - 42285235
Alignment:
| Q |
96 |
cattttacatacataatcaatcaaacaatatgttactcgcatttctttttactttatatttagttatgtttttattagcttagttgtcaaaaatcacaat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42285128 |
cattttacatacataatcaatcaaacaatatgttactcgcatttctttttactttatatttagttatgtttttattagcttagttctcaaaaatcacaac |
42285227 |
T |
 |
| Q |
196 |
ggaagaac |
203 |
Q |
| |
|
|||||||| |
|
|
| T |
42285228 |
ggaagaac |
42285235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 17 - 101
Target Start/End: Original strand, 42283756 - 42283840
Alignment:
| Q |
17 |
taggtgttactagaaagtttagtggaataacgatagtcatagttgagtctcattgtttacaaatgccgtttgtaaatttcatttt |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
42283756 |
taggtgtttctagaaagtttagtggaataatgatagtcatagttgagtctcattgtttacaaatgccatttgtaaattttatttt |
42283840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University