View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19599_high_18 (Length: 208)
Name: NF19599_high_18
Description: NF19599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19599_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 188
Target Start/End: Complemental strand, 35388734 - 35388566
Alignment:
| Q |
20 |
tgaagcaggtacccaacaactgattgatgctttaaattatgcatgtggagctggtgctgattgcggtcctattcaacctggtggaagttgttattatcca |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35388734 |
tgaagcaggtacccaacaactgcttgatgctttaaattatgcatgtggagctggtgctgattgcggtcctattcaacctggtggaagttgttattatcca |
35388635 |
T |
|
| Q |
120 |
aacacacttcaaaatcatgcttcctatgctttcaatagctattatcagaaagctcgtggctcttgtgat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35388634 |
aacacacttcaaaatcatgcttcctatgctttcaatagctattatcagaaagctcgtggctcttgtgat |
35388566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 46 - 151
Target Start/End: Complemental strand, 35392438 - 35392333
Alignment:
| Q |
46 |
atgctttaaattatgcatgtggagctggtgctgattgcggtcctattcaacctggtggaagttgttattatccaaacacacttcaaaatcatgcttccta |
145 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||| || |||||||| ||||||||||| || | | |||||||||||||||||| ||||||||| || |
|
|
| T |
35392438 |
atgctttaaattatgcatgttcaaatggagctgattgtggacctattcagcctggtggaagctgctttaatccaaacacacttcaaagtcatgcttcata |
35392339 |
T |
|
| Q |
146 |
tgcttt |
151 |
Q |
| |
|
|||||| |
|
|
| T |
35392338 |
tgcttt |
35392333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 46 - 151
Target Start/End: Complemental strand, 35403208 - 35403103
Alignment:
| Q |
46 |
atgctttaaattatgcatgtggagctggtgctgattgcggtcctattcaacctggtggaagttgttattatccaaacacacttcaaaatcatgcttccta |
145 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||| || |||||||| ||||||||||| || | | |||||||||||||||||| ||||||||| || |
|
|
| T |
35403208 |
atgctttaaattatgcatgttcaaatggagctgattgtggacctattcagcctggtggaagctgctttaatccaaacacacttcaaagtcatgcttcata |
35403109 |
T |
|
| Q |
146 |
tgcttt |
151 |
Q |
| |
|
|||||| |
|
|
| T |
35403108 |
tgcttt |
35403103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University