View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1959_high_3 (Length: 245)
Name: NF1959_high_3
Description: NF1959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1959_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 165
Target Start/End: Complemental strand, 394754 - 394606
Alignment:
| Q |
17 |
ttttttccttgaacaaagaggggaccatttaaaattttggtggaattatgtgatgtacaactttttggttgtgtagagaaaaggtaaaggaaatgcagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394754 |
ttttttccttgaacaaagaggggaccatttaaaattttggtggaattatgtgatgtacaactttttggttgtgtagagaaaaggtaaaggaaatgcagta |
394655 |
T |
 |
| Q |
117 |
atagaaaaatgaaacataaacttaccaagcttcatcacaagatgcttta |
165 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
394654 |
atagaaaaatgaaacataaactaaccaagcttcatcacaagatgcttta |
394606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 165 - 245
Target Start/End: Complemental strand, 394579 - 394499
Alignment:
| Q |
165 |
attcagaagttgaaattagctagaaatatatggtcactaatttttgaaagtctaagtaattaccagaatatatggcaagta |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394579 |
attcagaagttgaaattagctagaaatatatggtcactaatttttgaaagtctaagtaattaccagaatatatggcaagta |
394499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University