View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1959_high_5 (Length: 219)

Name: NF1959_high_5
Description: NF1959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1959_high_5
NF1959_high_5
[»] chr4 (1 HSPs)
chr4 (15-203)||(46040705-46040893)


Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 46040705 - 46040893
Alignment:
15 gatgaattagtagaagccataatgccgaacatgaatgcagaagtattggtgaatcaagaacaacttataggtgtgttcaagtgcttcgatcgcgatggga 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46040705 gatgaattagtagaagccataatgccgaacatgaatgcagaagtattggtgaatcaagaacaacttataggtgtgttcaagtgcttcgatcgcgatggga 46040804  T
115 atggattcatttcagcagctgaattggctggagcaatggctaaaatgggtcagccacttacatacaaagagcttattgagatgattaga 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46040805 atggattcatttcagcagctgaattggctggagcaatggctaaaatgggtcagccacttacatacaaagagcttattgagatgattaga 46040893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University