View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1959_low_4 (Length: 249)
Name: NF1959_low_4
Description: NF1959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1959_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 30340178 - 30340217
Alignment:
| Q |
202 |
ctcttcaaattgcctttaagttgcaacttatgttcatctc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30340178 |
ctcttcaaattgcctttaagttgcaacttatgttcatctc |
30340217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 210
Target Start/End: Original strand, 30339960 - 30339992
Alignment:
| Q |
178 |
agtttctctctccttctctcatatctcttcaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30339960 |
agtttctctctccttctctcatatctcttcaaa |
30339992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University