View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19601_high_12 (Length: 363)
Name: NF19601_high_12
Description: NF19601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19601_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 119 - 241
Target Start/End: Original strand, 32570616 - 32570738
Alignment:
| Q |
119 |
ttttgaaggtaaagaatctatgtcatgaaaatgtaaaacttacccagaaacaagtcgaaggttgtcttcataacgttgtctttgtctccccgttcttgct |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32570616 |
ttttgaagataaagaatctatgtcatgaaaatgtaaaacttacccagaaacaagtcgaaggttgtcttcataacgttgtctttgtctccccgttcttgct |
32570715 |
T |
|
| Q |
219 |
ggcacaaacgacatagattctag |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32570716 |
ggcacaaacgacatagattctag |
32570738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 10 - 67
Target Start/End: Original strand, 32570511 - 32570568
Alignment:
| Q |
10 |
catcatcaacacaaaacaattcaatcatatcaataagcacaataatgcatggtcataa |
67 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32570511 |
catcaacaacacaaaacaattcaatcatatcaataagcacaataatgcatggtcataa |
32570568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University