View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19601_high_18 (Length: 295)
Name: NF19601_high_18
Description: NF19601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19601_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 33 - 170
Target Start/End: Original strand, 18422860 - 18422997
Alignment:
| Q |
33 |
gaagacaaattttgaagaactagaccaaaaccctaaagaagaaagtattaaacaatcgtctcttgaaaaattgtatctgtaaaaagtatgtgaaggaaca |
132 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
18422860 |
gaagacaaattttgaaggactagaccaaaaccctaaagaagaaagtattaaacaagtgtctcttgaaaaattgtacctgtaaaaagtatgtgaagggaca |
18422959 |
T |
 |
| Q |
133 |
aagagtagtgatgtgataataaacaggcaacaaatcaa |
170 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
18422960 |
aagagtagtgcggtgataataaacaagcaacaaatcaa |
18422997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 38060140 - 38060099
Alignment:
| Q |
177 |
ctatattcaggtaaacccaatctatttctaatgaaagcattt |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
38060140 |
ctatattcaggtaaactcaatctatttcttatgaaagcattt |
38060099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University