View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19601_low_14 (Length: 340)
Name: NF19601_low_14
Description: NF19601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19601_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 11 - 321
Target Start/End: Original strand, 54854406 - 54854716
Alignment:
| Q |
11 |
cacagagttgaatgcaaaggggtagacacttcaatgtcaaagagaggcagggtcaagaatagggcttgagtgattaaaccgggggttagccccttattta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54854406 |
cacagagttgaatgcaaaggggtagacacttcaatgtcaaagagaggcagggtcaagaatagggcttgagtgattaaaccgggggttagccccttattta |
54854505 |
T |
 |
| Q |
111 |
tagtagttttgggccttggattatgttatgattgatgcattttgattggttgattccatcatccttatcctcagttcagctctgctgtaaacctgatttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54854506 |
tagtagttttgggccttggattatgttatgattgatgcattttgattggttgattccatcatccttatcctcagttcagctccgctgtaaacctgatttg |
54854605 |
T |
 |
| Q |
211 |
gatgaggactagagtgctgcgcctcaacaatggatctttatctggattctggctaatgtattgttgtttattgctcaaaattttcatggcaggtattgta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54854606 |
gatgaggactagagtgctgcgcctcaacaatggatctttatctggattctggctaatgtattgttgttcattgctcaaaattttcatggcaggtattgta |
54854705 |
T |
 |
| Q |
311 |
aatgtgagatg |
321 |
Q |
| |
|
||||||||||| |
|
|
| T |
54854706 |
aatgtgagatg |
54854716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University