View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19601_low_22 (Length: 251)
Name: NF19601_low_22
Description: NF19601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19601_low_22 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 6366710 - 6366950
Alignment:
| Q |
11 |
caaaggaacgaggcagagatattcaagggggaagcaatatgcaagcaaaaatcacggcttctcctagacgaaatgttgcttccaagaggattgcttcctt |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6366710 |
caaaggaatgaggcagagatattcaagggggaagcaatatgcaagcaaaaatcacggcttctcctagacgaaatgttgcttccaagaggattgcttcctt |
6366809 |
T |
 |
| Q |
111 |
tggacaacattgtggaaatgggtatcaaccgtgtcacaggtttcgtgtggctcaggcaaagacnnnnnnnggtgcaccggttcaatgccattggtcgcac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
6366810 |
tggacaacattgtggaaatgggtatcaaccgtgtcacaggtttcgtgtggctcaggcaaagacaaaaaaaggtgcaccggttcaatgccatcggtcgcac |
6366909 |
T |
 |
| Q |
211 |
ggtttcctttgatacagaggtcacggccttcgtggaggaac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6366910 |
ggtttcctttgatacagaggtcacggccttcgtggaggaac |
6366950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University