View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19601_low_24 (Length: 245)

Name: NF19601_low_24
Description: NF19601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19601_low_24
NF19601_low_24
[»] chr4 (1 HSPs)
chr4 (11-227)||(44474271-44474487)
[»] chr8 (3 HSPs)
chr8 (6-227)||(38453853-38454074)
chr8 (10-171)||(39848164-39848325)
chr8 (33-75)||(36951394-36951436)
[»] chr3 (1 HSPs)
chr3 (11-125)||(7046154-7046268)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 11 - 227
Target Start/End: Original strand, 44474271 - 44474487
Alignment:
11 ccgtcatggtaatggcacccaaacttggaaggatggaactatctacattggaaattggaaaaaagatctaccagatggaagagggattgtcagttgggat 110  Q
    |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||| ||| ||||| |    
44474271 ccgtcatggtaatggcaccctaactttgaaggatggaactatctacattggaaattggaaaaaagatacaccagatggaagagggattttcacttgggct 44474370  T
111 attggcgatgtttttattggttctcggttaactggcattgtacatggatttggagtttttatatctctaggtgggaatgtctatactggaaattggaaaa 210  Q
    |||||||||||||||||||||||| ||| || |||| |||||||||||||||||||||||| |||||||| |||| |||||||  |||||||||||||||    
44474371 attggcgatgtttttattggttcttggtcaaatggccttgtacatggatttggagtttttacatctctagatggggatgtctacgctggaaattggaaaa 44474470  T
211 caggtaaattggatgga 227  Q
    |||| ||||||||||||    
44474471 cagggaaattggatgga 44474487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 38454074 - 38453853
Alignment:
6 gattgccgtcatggtaatggcacccaaacttggaaggatggaactatctacattggaaattggaaaaaagatctaccagatggaagagggattgtcagtt 105  Q
    ||||||||||||||||||||||||||||||||||||||||||  |||||||| |||||||||||||||||||  |  |||||||||||||| | | ||||    
38454074 gattgccgtcatggtaatggcacccaaacttggaaggatggaggtatctacactggaaattggaaaaaagataaaagagatggaagagggactatgagtt 38453975  T
106 gggatattggcgatgtttttattggttctcggttaactggcattgtacatggatttggagtttttatatctctaggtgggaatgtctatactggaaattg 205  Q
    ||  |  ||| |||||||||  ||||| | ||| || | |  |||||||||||| |||||||| || |||| ||  |||| ||||  | |||||||||||    
38453974 ggcctgatggtgatgtttttgatggttgttggtcaaatagacttgtacatggatatggagtttatagatctgtaaatggggatgttaacactggaaattg 38453875  T
206 gaaaacaggtaaattggatgga 227  Q
    |||| |||| | ||||||||||    
38453874 gaaagcagggagattggatgga 38453853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 10 - 171
Target Start/End: Original strand, 39848164 - 39848325
Alignment:
10 gccgtcatggtaatggcacccaaacttggaaggatggaactatctacattggaaattggaaaaaagatctaccagatggaagagggattgtcagttggga 109  Q
    |||||||||| ||||||||||||||||  ||| |||||  || |||| |||||||||||||||| |||  |  |||||||||||||||||  | || ||     
39848164 gccgtcatggcaatggcacccaaacttataagaatggaggtagctacgttggaaattggaaaaatgataaaaaagatggaagagggattgagactttggc 39848263  T
110 tattggcgatgtttttattggttctcggttaactggcattgtacatggatttggagttttta 171  Q
    || ||| |||||||||| ||||| | ||| || || | ||||| |||||| |||||||||||    
39848264 taatggtgatgtttttaatggttgttggtcaaatgactttgtatatggatatggagttttta 39848325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 75
Target Start/End: Original strand, 36951394 - 36951436
Alignment:
33 acttggaaggatggaactatctacattggaaattggaaaaaag 75  Q
    |||||||| ||||||| |||||| |||||||||||||||||||    
36951394 acttggaatgatggaagtatctatattggaaattggaaaaaag 36951436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 11 - 125
Target Start/End: Complemental strand, 7046268 - 7046154
Alignment:
11 ccgtcatggtaatggcacccaaacttggaaggatggaactatctacattggaaattggaaaaaagatctaccagatggaagagggattgtcagttgggat 110  Q
    |||||||||||| |||||||| |||||||| ||||||| |  |||| ||||||||||||||||||||  |   ||||||| ||||||||| ||||||| |    
7046268 ccgtcatggtaagggcacccagacttggaaagatggaaatgactacgttggaaattggaaaaaagataaaatggatggaaaagggattgtgagttgggct 7046169  T
111 attggcgatgttttt 125  Q
    | ||| ||| |||||    
7046168 aatggtgattttttt 7046154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University