View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19601_low_27 (Length: 238)

Name: NF19601_low_27
Description: NF19601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19601_low_27
NF19601_low_27
[»] chr3 (1 HSPs)
chr3 (18-225)||(12000242-12000446)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 12000446 - 12000242
Alignment:
18 gtatgtttgttgtcttaataattgctgaactgaactagtatgaagcatattaccatacaccgataagaactcggcttcaaaatctttctatcagaatttt 117  Q
    ||||||||||||||||||| ||||   |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||    
12000446 gtatgtttgttgtcttaatcattg---aactgaactagtatgaagcatattaccatatactgataagaactcggcttcaaaatctttctatcagaatttt 12000350  T
118 gataacattttagggtaaaaggagacggttagtatagacactaaacttgacactaaaaattgaaataagattcattaacagaacaaataaacttaagatc 217  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12000349 gataacattttagggtaaaaggagacggttagtttagacactaaacttgacactaaaaattgaaataagattcattaacagaacaaataaacttaagatc 12000250  T
218 tggaccta 225  Q
    ||||||||    
12000249 tggaccta 12000242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University