View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19601_low_28 (Length: 238)
Name: NF19601_low_28
Description: NF19601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19601_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 13 - 117
Target Start/End: Original strand, 32167026 - 32167129
Alignment:
| Q |
13 |
cattttggtctgcctattgaaatgaaattctgctaagcctctaacaacaattataaagctttatgcacaaacaaaaatctcatgagtatcttcaccgtgt |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32167026 |
cattttggtctgcctattgaaat-aaattctgctaagcctctaacaacaattataaagctttatgcacaaacaaaaatctcatgagtatcttcatcgtgt |
32167124 |
T |
 |
| Q |
113 |
cagac |
117 |
Q |
| |
|
||||| |
|
|
| T |
32167125 |
cagac |
32167129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 152 - 232
Target Start/End: Original strand, 32167164 - 32167244
Alignment:
| Q |
152 |
gaagttcacatatgtttaattaagcgataaccaacaaaaagaatgaaaacatggtaaaataatatgaacttatgctattat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32167164 |
gaagttcacatatgtttaattaagcgataaccaacaaaaagaatgaaaacatagtaaaataatatgaacttatgctattat |
32167244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University