View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19601_low_29 (Length: 235)
Name: NF19601_low_29
Description: NF19601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19601_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 214
Target Start/End: Original strand, 48569526 - 48569720
Alignment:
| Q |
19 |
gatgaattgatggagtattttcccgagcaggcagacttttttaacaaaattatcattagctgatgacggctgtttagttaaatgtatttcaaatgagttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48569526 |
gatgaattgatggagtattttcccgagcaggcagacttttttaacaaaattatcattggctgatgacggctgtttggttaaatgtatttcaaatgagttt |
48569625 |
T |
 |
| Q |
119 |
atttaattacatcaagaacatgaatgcaggtttatgagctcaacaatatgnnnnnnnattaaacgcaaattctggaggcttgtatatgatttagtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569626 |
atttaattacatcaagaacatgaatgcaggtttatgagctcaacaaaatg-ttttttattaaacgcaaattctggaggcttgtatatgatttagtg |
48569720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 85
Target Start/End: Original strand, 36145900 - 36145966
Alignment:
| Q |
19 |
gatgaattgatggagtattttcccgagcaggcagacttttttaacaaaattatcattagctgatgac |
85 |
Q |
| |
|
||||||||||||||||||||||| ||||| || || ||||| |||||||| |||||||||||||||| |
|
|
| T |
36145900 |
gatgaattgatggagtattttcctgagcaagctgagtttttaaacaaaatgatcattagctgatgac |
36145966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 10821488 - 10821422
Alignment:
| Q |
19 |
gatgaattgatggagtattttcccgagcaggcagacttttttaacaaaattatcattagctgatgac |
85 |
Q |
| |
|
||||||||||| ||||||||||| ||||| || || ||||| |||||||| |||||||||||||||| |
|
|
| T |
10821488 |
gatgaattgattgagtattttccagagcaagctgagtttttaaacaaaatgatcattagctgatgac |
10821422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University