View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19601_low_31 (Length: 223)
Name: NF19601_low_31
Description: NF19601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19601_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 12539867 - 12539671
Alignment:
| Q |
20 |
ggacgaggaggaggaaacagcttgttattgttgggaataataatagaagaagaaactgaaacagaaacagaa------gaggtaccaacatatcttatta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12539867 |
ggacgaggaggaggaaacagcttgttattgttgggaataataatagaagaagaaacagaaacagaaacagaaacagaagaggtaccaacatatcttatta |
12539768 |
T |
|
| Q |
114 |
accttgacaacattgttgttg---gcactgaatgtatgctttgcgcacaacagaagtaacaacacagattcaagattactaccgctaccctagctaa |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12539767 |
accttgacaacattgttgttgtttgcactgaatgtatgttttgcgcacaacagaagtaacaacacagattcaagattactaccgctaccctagctaa |
12539671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University