View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19602_high_41 (Length: 246)

Name: NF19602_high_41
Description: NF19602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19602_high_41
NF19602_high_41
[»] chr3 (1 HSPs)
chr3 (6-231)||(12135686-12135910)
[»] chr4 (1 HSPs)
chr4 (161-231)||(105984-106054)
[»] chr7 (1 HSPs)
chr7 (161-233)||(13054459-13054531)


Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 12135686 - 12135910
Alignment:
6 catcatattgttgttagttcattaannnnnnncacaacaaaattatatatatagaagnnnnnnnntgagtgaagtacaattagtacttgactcgataatt 105  Q
    |||||||||||||||||||||||||       |||||||||||||||||||||||||        |||| ||||||| ||||||||||||||||||||||    
12135686 catcatattgttgttagttcattaatttttttcacaacaaaattatatatatagaagaaaaaaaatgagcgaagtacgattagtacttgactcgataatt 12135785  T
106 agggagaactacaaggggtgttcgaccaaaacaaaatcaaatgttaaagaaatttaaccttcttagggcttgacagatagctttccccccacccgccatc 205  Q
    |||||||| |||||||||||||||||||||| |||| ||||||||  |||||||||||||| |||||||||||||||||||||||||||||||||||||     
12135786 agggagaagtacaaggggtgttcgaccaaaaaaaaa-caaatgttgcagaaatttaaccttattagggcttgacagatagctttccccccacccgccatt 12135884  T
206 ttctccttgagttgcgagaagaaatt 231  Q
    ||||||||| |||| |||||||||||    
12135885 ttctccttgcgttgtgagaagaaatt 12135910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 231
Target Start/End: Complemental strand, 106054 - 105984
Alignment:
161 aaccttcttagggcttgacagatagctttccccccacccgccatcttctccttgagttgcgagaagaaatt 231  Q
    |||||| || |||||||| |||||||| ||||||||||| ||||| ||||  || |||| |||||||||||    
106054 aaccttttttgggcttgaaagatagctctccccccacccaccatcctctctctgtgttgtgagaagaaatt 105984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 233
Target Start/End: Complemental strand, 13054531 - 13054459
Alignment:
161 aaccttcttagggcttgacagatagctttccccccacccgccatcttctccttgagttgcgagaagaaattga 233  Q
    |||||| || |||| ||| |||||||| || |||||||| ||||| |||| ||| |||| |||||||||||||    
13054531 aaccttttttgggcatgaaagatagctctctccccacccaccatcctctctttgtgttgagagaagaaattga 13054459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University