View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19602_high_48 (Length: 236)
Name: NF19602_high_48
Description: NF19602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19602_high_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 15 - 229
Target Start/End: Complemental strand, 41615136 - 41614922
Alignment:
| Q |
15 |
agattattgaaaagtgaaaacacaatgcccccaacaattgggatgtaaaaataatattttatctatatgtagggaaactttaacttaccaaacaaaatta |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41615136 |
agatcattgaaaagtgaaaacacaatgcccctaacaattgggatgtaaaaataatattttatctatatgtagggaaactttaacttaccaaacaaaatta |
41615037 |
T |
|
| Q |
115 |
agttataaaagaaattcagaagtaaagcaaaggaatnnnnnnnnnttaagtagcagatgaatttgaaaacacaatgcccctaacaactgggaagtaaata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41615036 |
agttataaaagaaattcagaagtaaagcaaaggaataaaaaaaaattaagtagcagatgaatttgaaaacacaatgcccctaacaattgggaagtaaata |
41614937 |
T |
|
| Q |
215 |
tatcctcaattgata |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41614936 |
tatcctcaattgata |
41614922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University