View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19602_low_20 (Length: 358)
Name: NF19602_low_20
Description: NF19602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19602_low_20 |
 |  |
|
| [»] scaffold0236 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0236 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 15 - 342
Target Start/End: Original strand, 20583 - 20910
Alignment:
| Q |
15 |
aatatttagggttgtgaggtgcaacatcacacactctggtaacaacaaaaacacgcactttcatgcattcttctccctctatttataacaacacttttag |
114 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20583 |
aatatttggggttgtgaggtgcaacctcacacactctactaacaacaaaaacacgcactttcatgcattcttctccctctatttataacaacacttttag |
20682 |
T |
 |
| Q |
115 |
ttcacttcttcacatcaccttcaagtaacaacagtatcacatccatggcatccttcattgcaaaatccatatccatcatttctgacaccgtttcttcact |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20683 |
ttcatttcttcacatcaccttcaagtaacaacagtatcacatccatggcatccttcattgcaaaatccatatccatcatgtctgacaccgtttcttcact |
20782 |
T |
 |
| Q |
215 |
cacttccgatgtgaaggccattttcttcactctctgcaccatgttcctttgccttttcattggcattacaaaccttgcttttcttagcctatttataacc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20783 |
cacttccgatgtgaaggccattttcttcactctctgcaccatgttcctttgccttttcattggcattacaaaccttgcttttcttagcctatttataacc |
20882 |
T |
 |
| Q |
315 |
ccccttaaactcaacaccccccttgttc |
342 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
20883 |
ccccttaaactcaacaccccccttgttc |
20910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University