View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19602_low_30 (Length: 293)
Name: NF19602_low_30
Description: NF19602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19602_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 19 - 280
Target Start/End: Original strand, 41302496 - 41302757
Alignment:
| Q |
19 |
acaacatctttccgcggaatctgaacaaataagtcccacgaatccttaagatccccacacttagaatacatgctaatcaatgaagttactgcagttgtat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41302496 |
acaacatctttccgcggaatctgaacaaataagtcccacgaatccttaagatccccacacttagaatacatgctaatcaatgaagttactgcagttgtat |
41302595 |
T |
|
| Q |
119 |
ccctgctcaatggagatttacaaactaactgatgaacttgtttacccgtctgcaaagctgataaatcactacaacccaacaacacactagtcaagctcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41302596 |
ccctgctcaatggagatttacaaactaactgatgaacttgttttcccgtctgcaaagctgataaatcactacaacccaacaacacactagtcaagctcaa |
41302695 |
T |
|
| Q |
219 |
agcattaggtttaaccccagtttccaacattgtcttaaaaagctttaacccattctctgctc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41302696 |
agcattaggtttaaccccagtttccaacattgtcttaaaaagctttaacccattctctgctc |
41302757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University