View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19602_low_38 (Length: 266)
Name: NF19602_low_38
Description: NF19602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19602_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 109 - 254
Target Start/End: Original strand, 1332340 - 1332485
Alignment:
| Q |
109 |
tgatcatttatttgaagttgctcgagctcttttctttcacgaaaatatgtcttacttcactcgttctcaacctcatgtggagggtatgtgtgctccgact |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1332340 |
tgatcatttatttgaagttgctcgagctcttttctttcatgaaaatatgtcttacttcactcgtcctcaacctcatgtggagggtatgtgtgctccgact |
1332439 |
T |
|
| Q |
209 |
ttgagttcctaaaccttggtcatagcttccctaaaacacctgtctc |
254 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1332440 |
ttgagttcctaaaccctggtcatagcttccctaaaacacctgtctc |
1332485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 1332251 - 1332310
Alignment:
| Q |
19 |
tttccaactttatcagtaaaaagagcatcattcatgaatttacacgtgttgacatccgtc |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1332251 |
tttccaactttatcagtaaaaagagcatcattcatgaatttacacatgttgacatccgtc |
1332310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University