View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19602_low_40 (Length: 250)
Name: NF19602_low_40
Description: NF19602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19602_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 113 - 240
Target Start/End: Complemental strand, 30630319 - 30630192
Alignment:
| Q |
113 |
atcatttctcaaggttgaatggagtaagtagcattggagtaatggccaaccctttgatttcgaaccttctaatagatgagttgcccacgtttctataatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30630319 |
atcatttctcaaggttgaatggagtaagtagcattggagtaatggccaaccctttgatttcgaaccttctaatagatgagttgcccacgtttctataatg |
30630220 |
T |
 |
| Q |
213 |
tttctttgactcacgtgccaaccctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30630219 |
tttctttgactcacgtgccaaccctttg |
30630192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 30630427 - 30630374
Alignment:
| Q |
15 |
atatacaatatctcttaaacatacacaaaatatcaaagaacattgcatttgaca |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30630427 |
atatacaatatctcttaaacatacacaaaatatcaaagaacattgcatttgaca |
30630374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University