View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19602_low_42 (Length: 246)
Name: NF19602_low_42
Description: NF19602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19602_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 12135686 - 12135910
Alignment:
| Q |
6 |
catcatattgttgttagttcattaannnnnnncacaacaaaattatatatatagaagnnnnnnnntgagtgaagtacaattagtacttgactcgataatt |
105 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||| |
|
|
| T |
12135686 |
catcatattgttgttagttcattaatttttttcacaacaaaattatatatatagaagaaaaaaaatgagcgaagtacgattagtacttgactcgataatt |
12135785 |
T |
|
| Q |
106 |
agggagaactacaaggggtgttcgaccaaaacaaaatcaaatgttaaagaaatttaaccttcttagggcttgacagatagctttccccccacccgccatc |
205 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12135786 |
agggagaagtacaaggggtgttcgaccaaaaaaaaa-caaatgttgcagaaatttaaccttattagggcttgacagatagctttccccccacccgccatt |
12135884 |
T |
|
| Q |
206 |
ttctccttgagttgcgagaagaaatt |
231 |
Q |
| |
|
||||||||| |||| ||||||||||| |
|
|
| T |
12135885 |
ttctccttgcgttgtgagaagaaatt |
12135910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 231
Target Start/End: Complemental strand, 106054 - 105984
Alignment:
| Q |
161 |
aaccttcttagggcttgacagatagctttccccccacccgccatcttctccttgagttgcgagaagaaatt |
231 |
Q |
| |
|
|||||| || |||||||| |||||||| ||||||||||| ||||| |||| || |||| ||||||||||| |
|
|
| T |
106054 |
aaccttttttgggcttgaaagatagctctccccccacccaccatcctctctctgtgttgtgagaagaaatt |
105984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 233
Target Start/End: Complemental strand, 13054531 - 13054459
Alignment:
| Q |
161 |
aaccttcttagggcttgacagatagctttccccccacccgccatcttctccttgagttgcgagaagaaattga |
233 |
Q |
| |
|
|||||| || |||| ||| |||||||| || |||||||| ||||| |||| ||| |||| ||||||||||||| |
|
|
| T |
13054531 |
aaccttttttgggcatgaaagatagctctctccccacccaccatcctctctttgtgttgagagaagaaattga |
13054459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University