View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19602_low_44 (Length: 242)
Name: NF19602_low_44
Description: NF19602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19602_low_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 6 - 233
Target Start/End: Original strand, 4504520 - 4504743
Alignment:
| Q |
6 |
ttttcttcttatattcttgaacttgttgtattgttttgtgttttattgaaattattgtgtgctattgtctcgtcaatattctcaggnnnnnnnnnnnatg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4504520 |
ttttcttcttatattcttgaacttgttgtattgttttgtgttttattgaaattattgtgtgctattgtctcgtcaatattctcagg---ttttttttatg |
4504616 |
T |
|
| Q |
106 |
gaaaagctgcttcaactgaattaacttttttaacaaattcaagtttttccctnnnnnnnnnnnngaaacaaattcaagaagttttatcttatatgtttac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4504617 |
gaaaagctgcttcaactgaattaacttttttaacaaattcaagtttttccct-aaaaaaaaaaagaaacaaattcaagaagttttatcttatatgtttac |
4504715 |
T |
|
| Q |
206 |
tttaatttcttcttagtgttgggatatt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4504716 |
tttaatttcttcttagtgttgggatatt |
4504743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University