View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19602_low_50 (Length: 227)
Name: NF19602_low_50
Description: NF19602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19602_low_50 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 2 - 220
Target Start/End: Complemental strand, 18077045 - 18076827
Alignment:
| Q |
2 |
ccttcaccgcggttcaacgacgcggattaagaaataacatcgaaagcatgtgccacgttggcgccctctgacggtaccgtttgggcgccaacatgaaaag |
101 |
Q |
| |
|
||||||||| |||||||||||| |||| |||| ||||||||| ||||||||||| || | ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18077045 |
ccttcaccgtcgttcaacgacgctgattcagaactaacatcgatagcatgtgccaagtcatctccctctgacggtaccgtttgggcgccaacattcaaag |
18076946 |
T |
 |
| Q |
102 |
aaggctgtgtttctcgatcatcctctgggtatgggacagtgggtgtgactttgattctcactatataggtgactatgtgggggttctcttctcccgccat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
18076945 |
taggctgtgtttctcgatcatcctctgggtatgggaccgtgagtgtgactttgattttcactatatatgtgactatgtggtggttctcttctcccgccat |
18076846 |
T |
 |
| Q |
202 |
agaaatttgaaatgcaggt |
220 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
18076845 |
agaaatttgaaatgcaggt |
18076827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 144 - 218
Target Start/End: Complemental strand, 51454214 - 51454140
Alignment:
| Q |
144 |
gtgtgactttgattctcactatataggtgactatgtgggggttctcttctcccgccatagaaatttgaaatgcag |
218 |
Q |
| |
|
|||||||||||||| |||||||||| |||||| ||||| ||||||||| ||||||| ||||||| ||||||| |
|
|
| T |
51454214 |
gtgtgactttgattttcactatataagtgactgtgtggttgttctcttcctccgccattgaaatttcgaatgcag |
51454140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 221
Target Start/End: Complemental strand, 51478415 - 51478319
Alignment:
| Q |
125 |
tctgggtatgggacagtgggtgtgactttgattctcactatataggtgactatgtgggggttctcttctcccgccatagaaatttgaaatgcaggtg |
221 |
Q |
| |
|
||||||| ||||| ||| || ||||||||||| |||||||||| |||||||||| ||||||||| | ||||| ||||||| ||||||||||| |
|
|
| T |
51478415 |
tctgggtccgggacggtgagtatgactttgattttcactatatacgtgactatgtcattgttctcttcctcagccattgaaatttcaaatgcaggtg |
51478319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University