View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19602_low_51 (Length: 226)

Name: NF19602_low_51
Description: NF19602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19602_low_51
NF19602_low_51
[»] chr6 (1 HSPs)
chr6 (1-226)||(32325680-32325909)


Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 32325680 - 32325909
Alignment:
1 aaaaggggtaaaaggagaaagnnnnnnntatctatgatgtctcttcaccctctcttaccacaatataatacctattgacagtagtatatctcaactcctt 100  Q
    |||||||||||||||||||||       ||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||| |||||||    
32325680 aaaaggggtaaaaggagaaagaaaaaaatatctatgatgtctcttcaccctctcttaccgcaatataataccgattgacagcagtatatctcgactcctt 32325779  T
101 gagaggttgccgagacatcaaagaatcc----nnnnnnnttatgtannnnnnnncacgtcattaaagttaaaacgacgtgaaaagcaaaatactttaggt 196  Q
    |||||||||||||||||||||| ||| |           |||||||        ||||||||||||||||||||||||||||||||||||||||||||||    
32325780 gagaggttgccgagacatcaaataatacaaaaaaaaatattatgtattttttttcacgtcattaaagttaaaacgacgtgaaaagcaaaatactttaggt 32325879  T
197 ttaaaagagtgaaatgaaaaattgaagtga 226  Q
    ||||||||||||||||||||||||||||||    
32325880 ttaaaagagtgaaatgaaaaattgaagtga 32325909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University