View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_high_18 (Length: 252)
Name: NF19603_high_18
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_high_18 |
 | |
|
| [»] scaffold0450 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0450 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: scaffold0450
Description:
Target: scaffold0450; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 10560 - 10785
Alignment:
| Q |
1 |
tctttatttaaatcacatatttattttgttttattattcaaatgattgacaaaatctcatactgatcaggcaagtatattatcagctactgatcaggcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10560 |
tctttatttaaatcacatatttattttgttttattattcaaataattgacaaaatttcatactgatcaggcaagtatat---cagctactgatcaggcaa |
10656 |
T |
|
| Q |
101 |
ctacatcagctactaatcaggcaagtaaacttgttaaaataaatgtttgtttattgcaattcannnnnnnaaatacttctaagttctaacaagatgcaat |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
10657 |
gtacatcagctaataatcaggcaagtaaacttgttaaaataaatgtttgtttattgcaattaatttttttaaatac-------ttctaacaagatgcaat |
10749 |
T |
|
| Q |
201 |
ttaaccatatttataataatgcaggaatttgatatg |
236 |
Q |
| |
|
|| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
10750 |
tttaccgtatttataataatgcaggaatttgatatg |
10785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University