View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_high_2 (Length: 451)
Name: NF19603_high_2
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 16 - 278
Target Start/End: Complemental strand, 16908961 - 16908701
Alignment:
| Q |
16 |
atatcacaatgaattcagcagaagttgaatttcaaattatataaaaattccaattttaattgctttttgttcacctattaaaataatgaatttaagattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16908961 |
atatcacaatgaattcagcagaagttgaatttcaaattatataaaa-ttccaattttaattgctttttgttcacctattaaaataatgaatttaagattt |
16908863 |
T |
 |
| Q |
116 |
tatgaaatttgaggtatccgagccataagggacacattcataaattttggtcagtgggacatgtttgcaaaccttattatatggtgaagcaattaattat |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16908862 |
tatgaaatttgaggtatccgagccatgagggacacattcataaatttttgtcagtgggacatgtttgcaaaccttattatatggtgaagcaattaattat |
16908763 |
T |
 |
| Q |
216 |
gcatnnnnnnntacatgcatggtcaattcaataataaaatataaagtatggcaatttttgggg |
278 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16908762 |
gcat-aaaaaatacatgcatggtcaattcaataataaaatataaagtatggcaatttttgggg |
16908701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 327 - 429
Target Start/End: Complemental strand, 16908655 - 16908554
Alignment:
| Q |
327 |
tacttggactttatttttggtttgatttgatcagcttatttttatctcatgaaattggtttggtgcaatttagcttatttcctcgtatttctcatttcta |
426 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16908655 |
tacttggactttattgttggtttgatt-gatcagcttatttttatctcatgaaattggtttggtgcaatttagcttatttcctcgtatttctcatttcta |
16908557 |
T |
 |
| Q |
427 |
gac |
429 |
Q |
| |
|
||| |
|
|
| T |
16908556 |
gac |
16908554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University