View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_high_24 (Length: 231)
Name: NF19603_high_24
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 204
Target Start/End: Complemental strand, 27823187 - 27822989
Alignment:
| Q |
6 |
tctagtccttaaaattttatggtttggtagtctggttttctaaatttatgaaatgataaatctgggtagattttaacgtgcgcataatccttcgaaatta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27823187 |
tctagtccttaaaattttatggtttggtagtctgattttctaaatttatgaaatgataaatctgggtagattttaacgtgcacataatccttcgaaatta |
27823088 |
T |
|
| Q |
106 |
tatatccttagaattgagaactaaaatgatggttaactctattagacgacataatcaactgtgtctctaaagatgaatcagaacagaaacgccccccaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27823087 |
tatatccttagaattgagaactaaaatgatggttaactctattagacgacataatcaactgtgtctctaaagatgaatcagaacagaaacgccccccaa |
27822989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University