View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_high_29 (Length: 209)
Name: NF19603_high_29
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_high_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 24212044 - 24211859
Alignment:
| Q |
16 |
atgatgatgttagaaaattgctcaataggacttttcaattgttcatatgtgacattgccctaaacaaaatcc----aatgtccattttggaagttacaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
24212044 |
atgatgatgttagaaaattgctcaataggacttttcaattgttcatatgtgacatttccctaaacaaaatccttaaaatgtccattttgaaagttacaaa |
24211945 |
T |
|
| Q |
112 |
ctgatcacatctaactgtaactctctgtcgcacaagtttggatgttacaatcctatctgattttacatatatatcagacacaggtt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
24211944 |
ctgatcacatctaactgtaactctctgtcgcacaagtttggatgttacaatcctatctgcttttacatatatatcagacaccggtt |
24211859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 24208292 - 24208246
Alignment:
| Q |
20 |
tgatgttagaaaattgctcaataggacttttcaattgttcatatgtg |
66 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
24208292 |
tgatgttagaaaattgctcaagaggacttttcaattgttcacatgtg |
24208246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 88 - 169
Target Start/End: Complemental strand, 24208189 - 24208108
Alignment:
| Q |
88 |
aatgtccattttggaagttacaaactgatcacatctaactgtaactctctgtcgcacaagtttggatgttacaatcctatct |
169 |
Q |
| |
|
|||||||||||| |||||| |||| |||||||||||| |||||| || |||| ||||||| |||||||| |||| |||| |
|
|
| T |
24208189 |
aatgtccattttagaagttctgaacttatcacatctaacagtaactttcattcgctcaagtttagatgttacgatccaatct |
24208108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University